Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circ_0000523 | |||
Gene | METTL3 | Organism | Human |
Genome Locus | chr14:21971315-21972024:- | Build | hg19 |
Disease | Colorectal Cancer | ICD-10 | Malignant neoplasm of rectosigmoid junction (C19) |
DBLink | Link to database | PMID | 30403259 |
Experimental Method | |||
Sample Type | Cell lines | Comparison | n/a |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward CAGCATCGGAACCAGCAAAG ReverseCTGGGCTGTCACTACGGAAG | Statistics | Fold Change : Downregulated pvalue : p<0.05 |
Citation | |||
Jin, Y, Yu, LL, Zhang, B, Liu, CF, Chen, Y (2018). Circular RNA hsa_circ_0000523 regulates the proliferation and apoptosis of colorectal cancer cells as miRNA sponge. Braz. J. Med. Biol. Res., 51, 12:e7811. |